The hormone that regulates the concentration of calcium & phosphorus in ECF:

TLS Online TPP Program

#Question id: 1917

#Unit 4. Cell Communication and Cell Signaling

Boon et al. showed that syngeneic transplantable tumors that mutate such that they express strong transplantation antigens are rejected. They called these variants:

TLS Online TPP Program

#Question id: 13101

#Unit 13. Methods in Biology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 4085

#Unit 3. Fundamental Processes

When TAT protein fails to bind to the TAR region of the HIV transcript, which of the following statements is (are) true?

TLS Online TPP Program

#Question id: 15450

#Unit 4. Cell Communication and Cell Signaling

T-cell dependent response requires a signal is provided by an activated T cell, which binds to the B cell through,

a) lipopolysaccharide moiety

b) its antigen receptor 

c) A separate interaction between CD40L on the B cell and CD40 (CD154) on the activated TH cell

d) A separate interaction between CD40 on the B cell and CD40L (CD154) on the activated TH cell

TLS Online TPP Program

#Question id: 30082

#Unit 2. Cellular Organization

Hybrid dysgenesis is caused by which of the following transposable element?