Sp1 (Mr  80,000) is a transcription activator for a large number of genes in higher eukaryotes. Its DNA binding site, the GC box having consensus sequence

TLS Online TPP Program

#Question id: 4126

#Unit 3. Fundamental Processes

Which one of the following is true about the genetic code?

TLS Online TPP Program

#Question id: 18887

#Unit 13. Methods in Biology

Drumstick appearance in the microscopy is the distinguishing characteristics of:

TLS Online TPP Program

#Question id: 15267

#Unit 13. Methods in Biology

Which of the following is relatively more stable to heat

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 18990

#Unit 13. Methods in Biology

A list of reporter or marker genes used in gene transfers in animal cells with reporter gene and their source match them correctly

I - Chloramphenicol acetyltransferase (CAT)	A - Herpes simplex virus (HSY)
II - Luciferase (lux)	B - Pacific jellyfish (Aequoria victoria)
III - Green fluorescent protein (GFP)	C - Bacteria, firefly
IV - Thymidine kinase (Tk)	D - E. coli transposon Tn9