TLS Online TPP Program

#Question id: 4211


If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Unit 3. Fundamental Processes
  1. 6

  2. 14

  3. 10

  4. 7

More Questions
TLS Online TPP Program

#Question id: 2576

#Unit 2. Cellular Organization

What effect will addition of AMP-PNP have on axonal transport?

TLS Online TPP Program

#Question id: 2577

#Unit 2. Cellular Organization

Which of the following occur(s) during prophase?

a. Kinetochores capture microtubule (+) ends.

b. Chromosomes move poleward.

c. Chromosomes align on the spindle equator.

d. Centrosomes separate and the spindle begins to form.

e. Chromosome condensation begins.

TLS Online TPP Program

#Question id: 2578

#Unit 2. Cellular Organization

Following statements are regarding to proteins which involve actin filament assembly.

A. To nucleate the assembly of branched actin, Arp2/3 needs to be activated by interacting with a nucleation promoting factor (NPF), in addition to associating with the side of a pre-existing actin filament.

B. The NPF WASp is inactive due to an intramolecular interaction that masks the WCA domain.

C. Two NPFs each bind an actin subunit at their WH2 domains, and together, they activate the Arp2/3 complex through its interaction with their connector and acidic domains.

D. The NPF WASp is activated by a coincidence detection mechanism by which intramolecular interaction in WASp is relieved, allowing the W domain to bind actin and the acidic A domain to activate the Arp2/3 complex.

Which of the following statements represents regulation of the Arp2/3 complex by NPF?

TLS Online TPP Program

#Question id: 2579

#Unit 2. Cellular Organization

Match the following proteins (Column I) with their functions (Column II) during cell organization and movement.

Column I

Column II

A. Profilin

i. Actin nucleating protein

B. Formin

ii. ADP-actin binding protein

C. WASp

iii. Capping protein

D. Gelsolin

iv. Nucleation promoting factor

Which of the following is correct?

TLS Online TPP Program

#Question id: 2580

#Unit 2. Cellular Organization

Following statements are regarding to mechanism of kinesin-1 movement.

A. Initially leading head tightly bound to the microtubule and not bound by any nucleotide, while the trailing head is weakly bound to the microtubule and has ADP bound.

B. Binding of ATP induces a conformational change causing the linker to swing forward and dock into the head. This motion swings the former trailing head to become the leading head.

C. Binding of ATP induces a conformational change causing the linker to swing forward and dock into the head. This motion swings the former leading head to become the trailing head.

D. When leading head releases ADP and coordinately the trailing head hydrolyzes ATP to ADP + Pi. Pi is released and the linker becomes undocked.

E. When trailing head releases ADP and coordinately the leading head hydrolyzes ATP to ADP + Pi. Pi is released and the linker becomes undocked.

Which of the following combination is correct?

TLS Online TPP Program

#Question id: 2581

#Unit 2. Cellular Organization

Match the following toxins (Column I) with their effects (Column II) on actin.

Column I

Column II

A. Cytochalasin D

i. Enhances nucleation by binding and stabilizing actin dimers and thereby lowering the critical concentration.

B. Latrunculin

ii. Binds at the interface between subunits in

F-actin, locking adjacent subunits together and preventing actin filaments from depolymerizing.

C. Jasplakinolide

iii. Depolymerizes actin filaments by binding to the (+) end of F-actin, where it blocks further addition of subunits.

D. Phalloidin

iv. Binds and sequesters G-actin, inhibiting it from adding to a filament end.