TLS Online TPP Program

#Question id: 4211


If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Unit 3. Fundamental Processes
  1. 6

  2. 14

  3. 10

  4. 7

More Questions
TLS Online TPP Program

#Question id: 732

#Unit 1. Molecules and their Interaction Relevant to Biology

Ramachandran plots can help increase the accuracy of models derived from x-ray crystallography data. The plot below was created by measuring phi, and psi for each amino acid residue in a 2.2 A resolution crystal structure. In the plot, which excludes Gly and Pro residues, selected residues (dots) are numbered 1 through 5.

Which of the following statements can be correctly stated for this plot in reference to selected residues?

A. Residues 1 and 3 are in either B sheets

B. residue 2 is in a right-handed a helix, and residue 4 is in a left-handed a helix.

C. If residue 5 were Gly, it might be in an acceptable position in the plot

TLS Online TPP Program

#Question id: 733

#Unit 1. Molecules and their Interaction Relevant to Biology

Which one of the statements on protein conformation, detailed below is INCORRECT?

TLS Online TPP Program

#Question id: 734

#Unit 1. Molecules and their Interaction Relevant to Biology

Which of the following statements is true for two different tripeptides consisting of either glycine or proline?

TLS Online TPP Program

#Question id: 735

#Unit 1. Molecules and their Interaction Relevant to Biology

The a-keratin chains indicated by the diagram below have undergone one chemical step. To alter the shape of the a-keratin chains—as in hair waving—what subsequent steps are required?

TLS Online TPP Program

#Question id: 736

#Unit 1. Molecules and their Interaction Relevant to Biology

The most important contribution to the stability of a protein’s conformation appears to be the:

TLS Online TPP Program

#Question id: 737

#Unit 1. Molecules and their Interaction Relevant to Biology

Which structure below indicates the proper hydrogen-bonding pattern between amino acids in an α-helix? (Dashed lines represent the hydrogen bonds.)