TLS Online TPP Program

#Question id: 4211


If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Unit 3. Fundamental Processes
  1. 6

  2. 14

  3. 10

  4. 7

More Questions
TLS Online TPP Program

#Question id: 399

#Unit 1. Molecules and their Interaction Relevant to Biology

Calculate the pH of a 1 L solution containing 0.100 M formic acid and 0.100 M sodium formate before and after the addition of 1.00 mL of 5.00 M NaOH. How much would the pH change if the NaOH were added to 1.00 L of pure water? (pKa for formic acid is 3.75)

TLS Online TPP Program

#Question id: 27632

#Unit 1. Molecules and their Interaction Relevant to Biology

The two forms of poly(Pro) helix all cis (I) or all trans (II) peptide bonds with different no of amino acid per turn

(a) poly(Pro) I as a right-handed helix with 3.3 residues per turn 

(b) poly(Pro) I as a right-handed helix with 3 residues per turn 

(c) poly(Pro) II is a left-handed helix with 3 residues per turn.

(d) poly(Pro) II is a left-handed helix with 3.3 residues per turn.

Choose the correct options of the following

TLS Online TPP Program

#Question id: 3849

#Unit 3. Fundamental Processes

Which of the following is short 20 to 22-nucleotide single-stranded RNAs that block the expression of complementary or partially complementary mRNAs.

TLS Online TPP Program

#Question id: 15760

#Unit 5. Developmental Biology

Why Stem cells are sometimes referred to as “undifferentiated”?

TLS Online TPP Program

#Question id: 5712

#Unit 8. Inheritance Biology

In each of the following cases, determine the consequences of a single crossover within the inverted region of a pair of homologous chromosomes with the gene order A B C D in one chromosome and a c b d in the other. There is a two situation of centromere for that gene. 

(A) Centromere is not included within the inversion.

(B) Centromere is included within the inversion

Following consequence are resulting are

I - The crossover chromatids consist of a dicentric and an acentric

II- One Cross over product is duplicated for the terminal region contain in A and deficient for the terminal region containing D

III- Both cross over products is monocentric

Following is correct combination for consequence?