TLS Online TPP Program

#Question id: 4211


If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Unit 3. Fundamental Processes
  1. 6

  2. 14

  3. 10

  4. 7

More Questions
TLS Online TPP Program

#Question id: 13071

#Unit 13. Methods in Biology

Modifications of the agglutination reaction involve the use of ________particles, which allow the reaction to be observed more easily in the liquid phase

TLS Online TPP Program

#Question id: 13072

#Unit 13. Methods in Biology

Inheritance pattern of RFLP and RAPD markers for genome mapping in plants;

TLS Online TPP Program

#Question id: 13073

#Unit 13. Methods in Biology

Restriction enzymes must be use in RFLP and RAPD markers for genome mapping in plants;

TLS Online TPP Program

#Question id: 13074

#Unit 13. Methods in Biology

Type of probe used in RFLP;

TLS Online TPP Program

#Question id: 13075

#Unit 13. Methods in Biology

Radioisotopes must be used in RFLP and RAPD markers

TLS Online TPP Program

#Question id: 13076

#Unit 13. Methods in Biology

Restriction fragment length polymorphism denotes that a single restriction enzyme produces fragments of different lengths from the same stretch of genomic DNA of different strains of a species or from different related species. RFLPs are detected as follows:

i.  Large molecular weight genomic DNA is isolated from several strains or related species;

ii.  The fragments in these digests are separated through electrophoresis

iii.  These 'DNAs are then digested with a selected restriction enzyme

iv.  Exposed to a suitably radio-labelled appropriate DNA probe under conditions favouring DNA: DNA hybridization

v.  The resulting gel lanes are transferred and fixed to a suitable solid support and

vi.   The free probes are removed

vii.  The fragments to which the probe has hybridized are detected by filming them as distinct bands on a suitable photofilm through autoradiography.