TLS Online TPP Program

#Question id: 4211


If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Unit 3. Fundamental Processes
  1. 6

  2. 14

  3. 10

  4. 7

More Questions
TLS Online TPP Program

#Question id: 2871

#Unit 2. Cellular Organization

With respect to X-chromosome inactivation in females, which, if any, of the following statements is incorrect?

TLS Online TPP Program

#Question id: 2872

#Unit 2. Cellular Organization

Concerning disorders resulting from unstable expansion of tandem oligonucleotide repeats, which, if any of the following statements is false.

A) The expansions can occur in coding DNA in some cases, and in noncoding DNA in other cases.

B) The repeats are of a variable number of nucleotides (from three to six) in both coding DNA and noncoding DNA.

C) The expansions in noncoding DNA are generally much larger in size than those in coding DNA.

D) The expanded arrays in noncoding DNA always result in loss of function of the host gene or of a neighboring gene.

TLS Online TPP Program

#Question id: 2873

#Unit 2. Cellular Organization

With reference to aberrant methylation of bases which of the following statements, if any, is false?

TLS Online TPP Program

#Question id: 2874

#Unit 2. Cellular Organization

Match one item from numbered group A with a lettered item from group B.

GROUP I

GROUP II

1. Yeast artificial chromosomes

a. They are more stable

2. Bacterial artificial chromosome

b. It is very hard to construct

c. It is not so hard to construct

d. They are unstable

e. are used to clone the DNA inserts up to 300kb

f. are used for cloning very large (1000-2000kb) DNA segments


TLS Online TPP Program

#Question id: 2875

#Unit 2. Cellular Organization

Which of the following statements is/are CORRECT from the following?

I. The chromosome of the small monkey DNA virus SV40 is a circular, double-helical DNA molecule of 5000 bp.

II. The phage Lambda genome is a linear single-stranded molecule in the virion particle.

III. Circular DNA molecules purified from both bacteria and eukaryotes are usually negatively supercoiled, having values of sigma of approximately –0.06.

IV. Prokaryotes have a special type I topoisomerase known as “DNA gyrase” that introduces, rather than removes, negative supercoils.

V. DNA disentanglement, generally catalyzed by a type II topoisomerase, is also required for a successful round of DNA replication and cell division in eukaryotes.

TLS Online TPP Program

#Question id: 2876

#Unit 2. Cellular Organization

From the following set of statements regarding DNA topology, state whether each of the given statement is either True or False.

A.      The two strands of cccDNA can be easily separated without any breakage of bonds.

B.      Circular DNA molecules purified from bacteria and eukaryotes are usually negatively supercoiled.

C.      Interwound writhe and spiral writhe are topologically different.

D.      The organisms that live under extreme temperature conditions have been found to have positively supercoiled DNA.

E.      Negative supercoils can be thought of as a store of free energy that aids in processes that require strand separation.