Correct statement about two striking structural changes are seen in the enzyme upon isomerization from the closed to the open complex;

A. First, the pincers at the front of the enzyme clamp down tightly on the downstream DNA.

B. Second, there is a major shift in the position of the amino-terminal region of s. When not bound to DNA, s region 3.2 lies within the active center cleft of the holoenzyme, blocking the path that, in the open complex, is followed by the template DNA strand.

C. In the open complex, region 1.1 shifts some 50 A˚ and is now found on the outside of the enzyme, allowing the DNA access to the cleft.

D. Region 1.1 of s is highly negatively charged ( just like DNA).

TLS Online TPP Program

#Question id: 27088

#Unit 1. Molecules and their Interaction Relevant to Biology

What is the span of rotation of dihedral angles?

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 423

#Unit 1. Molecules and their Interaction Relevant to Biology

The glycolytic pathway oxidizes glucose to two molecules of pyruvate and also produces a net of two molecules of ATP. ATP allosterically inhibits the enzyme, PFK-1, that catalyzes the third step of glycolysis. This is an example of ________.

TLS Online TPP Program

#Question id: 12512

#Unit 7. System Physiology – Animal

Which of the following changes would you expect to find in a patient consuming a high-sodium diet (200 mEq/day) compared with the same patient on a normal-sodium diet (100 mEq/day), assuming steady-state conditions?

TLS Online TPP Program

#Question id: 11175

#Unit 10. Ecological Principles

Leks