In a testcross of an individual heterozygous for each of three linked genes, the most frequent classes of progeny were A B c/a b c and a b C/a b c, and the least frequent classes were A B C/a b c and a b c/a b c. what is the order of the genes?

#Question id: 1257

#Unit 4. Cell Communication and Cell Signaling

Following statements are regarding to protein kinase A which phosphorylates multiple intracellular target proteins expressed in different cell types.

A. Inactive PKA is a tetramer consisting of two regulatory (R) subunits and two catalytic (C) subunits.

B. Each R subunit contains a pseudo-substrate domain whose sequence resembles that of a peptide substrate and binds to the active site in the catalytic domain but is not phosphorylated; thus the pseudo-substrate domain inhibits the activity of the catalytic subunits.

C. active PKA is turned off by binding of cAMP Each R subunit has two distinct cAMP-binding sites, called CNB-A and CNB-B.

D. Binding of cAMP by an R subunit of PKA occurs in a cooperative fashion; that is, binding of the first cAMP molecule to CNB-B increases the Kd for binding of the second cAMP to CNB-A. Thus small changes in the level of cytosolic cAMP can cause proportionately large changes in the number of dissociated C subunits and, hence, in cellular kinase activity.

Which of the following statements are incorrect?

#Question id: 27642

#Unit 1. Molecules and their Interaction Relevant to Biology

Choose the incorrect statement regarding β-turns

#Question id: 4211

#Unit 3. Fundamental Processes

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Question id: 31101

#Unit 2. Cellular Organization

#Question id: 26480

#Unit 2. Cellular Organization

Optimal length of prokaryotic promoter should be