TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 24260
#Unit 2. Cellular Organization
Clock position of amino terminal tail of amino acid is fixed, so which of the following is correctly showing the position of H2B
TLS Online TPP Program
#Question id: 1761
#Unit 4. Cell Communication and Cell Signaling
Which of the following statements is TRUE of cytokines?
TLS Online TPP Program
#Question id: 13096
#Unit 13. Methods in Biology
You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program
#Question id: 5284
#Unit 8. Inheritance Biology
DNA from a strain of Bacillus subtilis with genotype a+b+ c+d+ e+ is used to transform a strain with genotype a - b- c- d- e-. Pairs of genes are checked for co-transformation and the following results are obtained:
Pair of co-transform genes as follow
D-E, E-C, C-B, A-D
On the basis of these results, what is the order of the genes on the bacterial chromosome?
TLS Online TPP Program
#Question id: 22939
#Unit 5. Developmental Biology
CO gene expression appears to be highest in the companion cells of the phloem of leaves and stems, the downstream target gene of CONSTANS is