Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 5415
TLS Online TPP Program

#Question id: 5677

During acrosome reaction, after binding with the egg many sperm membrane proteins are activated. Which of the following membrane protein is not activated?

#Unit 5. Developmental Biology

  1. A calcium transport channel that allows Ca2+ to enter the sperm head.

  2. a sodium-hydrogen exchanger that pumps sodium ions (Na+) into the sperm as it pumps hydrogen ions (H+) out.

  3. a phospholipase enzyme that activate IP3 pathway.

  4. a potassium-hydrogen exchanger that pumps potassium ions (k+) into the sperm as it pumps hydrogen ions (H+) out.

More Questions
TLS Online TPP Program

#Question id: 19991

#Unit 2. Cellular Organization

Consider 5000 bp with 1000 bp (1 Copy), 700 bp (5 Copies) and 100 bp (5 Copies) calculate complexity (N/L ratio) of genome?
TLS Online TPP Program

#Question id: 28184

#Unit 5. Developmental Biology

If cells are removed from the embryo, the remaining cells can regulate and compensate for the missing part, from these mode of specification is known as____
TLS Online TPP Program

#Question id: 12815

#General Aptitude

There is a rectangular tank of length 180 m and breadth 120m in a circular field. If the area of the land portion of the field is 40000 m2, what is the radius of the field ?  
TLS Online TPP Program

#Question id: 2621

#Unit 2. Cellular Organization

The leaky expression of lac genes ensures that,
TLS Online TPP Program

#Question id: 13101

#Unit 13. Methods in Biology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
 
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?