#Question id: 34121
#Unit 2. Cellular Organization
#Question id: 5361
#Unit 8. Inheritance Biology
The pedigree shows the inheritance of a RFLP marker through three generations in a single family. A total of 8 alleles (numbered to the left of the blots) are present in the family. The RFLPs of each member of the family are placed directly below his (squares) or her (circles) symbol and RFLP numbers. In Above pedigree, which of the following are not children of second generation parent?
#Question id: 7756
#Unit 5. Developmental Biology
#Question id: 4211
#Unit 3. Fundamental Processes
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
#Question id: 28062
#Unit 1. Molecules and their Interaction Relevant to Biology
Thermostable proteins are stable at high temperature due to
a. Vander Waals interaction
b. Ionic bond only
c. High protein’s hydrophobic core
d. high incidence of salt bridges