Ecosystem having a three trophic level in which number of species is given in table

 Total 50 number of link among these trophic levels present. What is value of connectance in ecosystem? 

TLS Online TPP Program

#Question id: 11535

#Unit 6. System Physiology – Plant

During IPA pathway in the biosynthesis of auxin using  following enzymes except_____

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 19792

#Unit 12. Applied Biology

Expression of BtR175 gene in mammalian cells enables Cry1Aa to bind the cells and cause their lysis. The specificity seems to be lost upon reduction of which amino acid residues of the protoxin, but can be restored by reoxidation of these residues?

TLS Online TPP Program

#Question id: 28053

#Unit 1. Molecules and their Interaction Relevant to Biology

The most important parameter relating to the energy of an H-bond in protein structure is 

TLS Online TPP Program

#Question id: 16116

#Unit 7. System Physiology – Animal

Which of the following hormones acts synergistically with sympathetic nervous system?