TLS Online TPP Program

#Question id: 11248


Which factor could not be considered a factor of environmental resistance?

#Unit 10. Ecological Principles
  1. Disease
  2. Predation
  3. Increased food supply
  4. Parasitism
More Questions
TLS Online TPP Program

#Question id: 3874

#Unit 3. Fundamental Processes

A branched (“lariat”) structure is formed during:

TLS Online TPP Program

#Question id: 9239

#Unit 9. Diversity of Life Forms

Why are changes in the global carbon cycle important?

TLS Online TPP Program

#Question id: 2665

#Unit 2. Cellular Organization

A transposon ____________.

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 12767

#Unit 10. Ecological Principles

Your friend comes to you with a problem. It seems his shrimp boats aren’t catching nearly as much shrimp as they used to. He can’t understand why because originally he caught all the shrimp he could handle. Each year he added a  new  boat,  and  for  a  long  time  each  boat  caught  tons  of  shrimp.  As  he  added  more  boats,  there  came  a  time when each boat caught somewhat fewer shrimp, and now, each boat is catching a lot less shrimp. Which of the following topics might help your friend understand the source of his problem?