Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 8746
TLS Online TPP Program

#Question id: 11964

 Animals cannot produce enzymes to digest cellulose, yet many termite species consume cellulose from plant material as a main part of their diet. How do termites access the nutrients contained in cellulose?

#Unit 7. System Physiology – Animal
  1. Termites have specialized mouthparts to mechanically break down the cellulose.
  2. The ingested plant material also contains enzymes for cellulose digestion.
  3. Cellulose is digested intracellularly in the termite hindgut.
  4. Mutualistic bacteria in the hindgut of the termite digest the cellulose into sugars.
More Questions
TLS Online TPP Program

#Question id: 15216

#Unit 13. Methods in Biology

There is no SDS in native (Buffer) Gels, but good resolution is achieved due to
TLS Online TPP Program

#Question id: 11637

#Unit 9. Diversity of Life Forms

Which of these statements about dinoflagellates is false?
TLS Online TPP Program

#Question id: 12442

#Unit 10. Ecological Principles

At low population densities, dispersers
TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.
TLS Online TPP Program

#Question id: 1283

#Unit 4. Cell Communication and Cell Signaling

Which one of the following is NOT a property of perlecan?