GroEL, GroES is an example of the  prokaryotic cell, this HSP protein is belong to the which of the following HSP class?

TLS Online TPP Program

#Question id: 19236

#Unit 12. Applied Biology

Which is the normal mode of DNA integration into the chloroplast genome.

TLS Online TPP Program

#Question id: 22957

#Unit 5. Developmental Biology

floral organ development is controlled by overlapping expressions of A class , B class and C class genes in different whorls. In an Arabidopsis mutant, the floral whorls had following pattern:

Sepal àSepal àcarpel àcarpel 

Mutation in which one of the following class of gene causes above pattern.  

TLS Online TPP Program

#Question id: 4211

#Unit 3. Fundamental Processes

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 27499

#Unit 1. Molecules and their Interaction Relevant to Biology

Which is the correct chair form of the β anomer of D-mannose?

TLS Online TPP Program

#Question id: 1281

#Unit 4. Cell Communication and Cell Signaling

Which of the following is the term used to describe a thin, sheet-like meshwork of extracellular matrix components that can be found in epithelial cells?