TLS Online TPP Program

#Question id: 13095


You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

#Unit 13. Methods in Biology
  1. -
  2. -
  3. -
  4. -
More Questions
TLS Online TPP Program

#Question id: 23564

#Unit 8. Inheritance Biology

Match the following

 

      Column I

 

      Column II

 

A) G-bands

 

i) viewing the chromosomes under ultraviolet light results from differences in the relative amounts of cytosine–guanine (C–G) and adenine–thymine base pairs

 

B) R-bands

 

ii) which are regions of DNA occupied by centromeric heterochromatin

 

C) Q-bands

 

iii) staining the telomere DNA  specifically

 

D) C-bands

 

iv) distinguish areas of DNA that are rich in adenine–thymine (A–T) base pairs

 

E) T-bands

 

v) reverting the dark bands by using saltingout method

TLS Online TPP Program

#Question id: 23565

#Unit 8. Inheritance Biology

Sequence rich with cytosine and guanine base pairs only that are detected by

TLS Online TPP Program

#Question id: 23566

#Unit 8. Inheritance Biology

C-bands involved for the detection of__

TLS Online TPP Program

#Question id: 23567

#Unit 8. Inheritance Biology

Telomeric staining specifically detected by_____

TLS Online TPP Program

#Question id: 23567

#Unit 8. Inheritance Biology

Telomeric staining specifically detected by_____

TLS Online TPP Program

#Question id: 23568

#Unit 8. Inheritance Biology

Match the following types of chromosomal rearrangements;

 

            COLUMN I

 

           COLUMN II

 

A) Tandem duplication

 

i) duplicated segment is located some distance from the original segment, either on the same chromosome or on a different one

 

B) Displaced duplication

 

ii) duplication can be in the same orientation as that of the original sequence

 

C) Inverted duplication

 

iii) the duplicated region is immediately adjacent to the original segment

 

D) Reverse duplication

 

 

iv)  duplication same as the reverse

Which of the following statements is correct?