TLS Online TPP Program

#Question id: 13095


You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

#Unit 13. Methods in Biology
  1. -
  2. -
  3. -
  4. -
More Questions
TLS Online TPP Program

#Question id: 5050

#Unit 5. Developmental Biology

A stem cell capable of producing all the cell types of a lineage(embryonic and extraembryonic) is said to be-

TLS Online TPP Program

#Question id: 5051

#Unit 5. Developmental Biology

after the 8-cell stage, the mammalian embryo develops an outer layer (which becomes the fetal portion of the placenta), and an inner cell mass that generates all the cells of embryo. The cells of the inner cell mass are thus said to be-

TLS Online TPP Program

#Question id: 5052

#Unit 5. Developmental Biology

cell populations within each germ layer expand and differentiate, resident stem cells are maintained within these developing tissues and function to generate cell types with restricted specificity for the tissue in which they reside. these stem cells are-

TLS Online TPP Program

#Question id: 5053

#Unit 5. Developmental Biology

Local cell signaling is carried out via membrane receptors that bind to proteins in the extracellular matrix (ECM) or directly to receptors from a neighboring cell in a process called as-

TLS Online TPP Program

#Question id: 5054

#Unit 5. Developmental Biology

when one group of cells changing the behavior of an adjacent set of cells, thereby causing them to change their shape, mitotic rate, or cell fate. This kind of interaction at close range between two or more cells or tissues of different histories and properties is called as-

TLS Online TPP Program

#Question id: 5055

#Unit 5. Developmental Biology

There are at least two components to every inductive interaction-