You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

#Question id: 888

#Unit 1. Molecules and their Interaction Relevant to Biology

Which one of the following statements about the protein folding is incorrect?

#Question id: 889

#Unit 1. Molecules and their Interaction Relevant to Biology

The cis and trans GroEL rings undergo conformational changes in a reciprocating fashion, with events in one ring influencing events in the other ring. The entire GroEL/ES chaperonin complex functions as follows;

a) One GroEL ring that has bound 7 ATP also binds an improperly folded substrate protein, which associates with hydrophobic patches that line the inner wall of the GroEL chamber

b) The GroES cap then binds to the GroEL ring like a lid on a pot, inducing a conformational change in the resulting cis ring

c) Within ~10 s the cis ring catalyzes the hydrolysis of its 7 bound ATPs and releases the resulting Pi , which weakens the interactions binding GroES to GroEL

d) A second molecule of improperly folded substrate protein binds to the cis ring, followed by 7 ATP

e) The binding of substrate protein and ATP to the cis ring conformationally induces the trans ring to release its bound GroES, 7 ADP, and the presumably now better-folded substrate protein

Which of the following is incorrect functions of GroEL/ES chaperonin complex?

#Question id: 890

#Unit 1. Molecules and their Interaction Relevant to Biology

Some of the misfolded protein or defective Protein causes disease as follows;

#Question id: 891

#Unit 1. Molecules and their Interaction Relevant to Biology

The folding pathways of some proteins require two enzymes that catalyze isomerization reactions such as,

a) Peptide prolyl isomerase (PPI)  catalyzes the elimination of folding intermediates with inappropriate disulfide cross-links

b) Protein disulfide isomerase (PDI) enzyme that catalyzes the interchange, or shuffling, of disulfide bonds until the bonds of the native conformation are formed

c) Peptide prolyl cis-trans isomerase (PPI) catalyzes the interconversion of the cis and trans isomers of Proline residue peptide bonds

d) Peptide prolyl isomerase (PPI) can be a fast step in the folding of proteins that contain some Pro peptide bonds in the cis conformation

Which of the following combinations is correct about protein folding pathways?

#Question id: 892

#Unit 1. Molecules and their Interaction Relevant to Biology

Assisted protein folding is mediated by a group of proteins known as chaperons, which of the following statements is incorrectly reperesents chaperon activity;

#Question id: 893

#Unit 1. Molecules and their Interaction Relevant to Biology

Like E.coli eukaryotic cells also contain chaperonin, which of the following in eukaryotic chapronin is incorrect?