TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 3673
#Part-A Aptitude & General Biotechnology
Which is a characteristic of E. coli DNA polymerases?
TLS Online TPP Program
#Question id: 786
#Part-A Aptitude & General Biotechnology
A = 27% G = 30% T = 21% C = 22%
If the genome of a newly isolated virus displays the base composition above, the virus most likely consists of ______.
TLS Online TPP Program
#Question id: 14118
#Part-A Aptitude & General Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 11452
#Part-A Aptitude & General Biotechnology
A given photon of light may trigger an action potential with thousands of times more energy because the signal strength is amplified by ________.
TLS Online TPP Program
#Question id: 5832
#Part-B Specialized Branches in Biotechnology
Mutagenic agents that can cause cancer are known specifically as: