The shortest alpha helix segment in a protein that will span a membrane bilayer has about.

TLS Online TPP Program

#Question id: 2292

#Part-A Aptitude & General Biotechnology

which one is not function of Golgi apparatus,

TLS Online TPP Program

#Question id: 5700

#Part-B Specialized Branches in Biotechnology

During meiosis, homologous chromosomes pair up along their lengths. The most plausible explanation for the karyotype structure shown above is that

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 2279

#Part-A Aptitude & General Biotechnology

Mitochondrial enzymes for oxidative metabolism are

TLS Online TPP Program

#Question id: 11612

#Part-B Specialized Branches in Biotechnology

AMO-1618, which blocks GA biosynthesis at the cyclization step, what would be the A, B and C represents. where, the control shows no inhibitor;