A plant height in Maize is control by 3 pair of polygene .Two varieties of maize averaging 120 and 60 inches in height, respectively, are crossed. The F1 progeny is quite uniform averaging 40 inches in height. What is proportional of F2 progeny that is display phenotype either 120 cm or 60 cm height?

TLS Online TPP Program

#Question id: 14116

#Part-A Aptitude & General Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 

P. A larger E-value indicates higher sequence similarity 

Q. E-value < 10^-10 indicates sequence homology 

R. A higher BLAST score indicates higher sequence similarity 

S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14117

#Part-B Specialized Branches in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14117

#Part-A Aptitude & General Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#Part-B Specialized Branches in Biotechnology

Which of the following is incorrect regarding sequence homology?