#Question id: 4211
#Part-A Aptitude & General Biotechnology
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
#Question id: 4302
#Part-A Aptitude & General Biotechnology
Which one of the following proteins is involved in promoter recognition in eukaryotes?
#Question id: 4303
#Part-A Aptitude & General Biotechnology
Which component is not directly involved in translation?
#Question id: 4304
#Part-A Aptitude & General Biotechnology
Using codon table, identify a 5′ → 3′ sequence of nucleotides in the DNA template strand for an mRNA coding for the polypeptide sequence Phe-Pro-Lys.
#Question id: 4305
#Part-A Aptitude & General Biotechnology
Which of the following molecules is a protein produced by a regulatory gene?
#Question id: 4306
#Part-A Aptitude & General Biotechnology
Which of the following molecules helps to "turn off" genes in a cell?
