TLS Online TPP Program

#Question id: 11279


Ecosystem A: Actual link 10, number of species 15  

Ecosystem B: Actual link 10, number of species 20   

Connectance of ecosystem A and B

#Part-B Specialized Branches in Biotechnology
  1. Greater in Ecosystem A  
  2. Greater in Ecosystem B              
  3. Equal in both ecosystem         
  4. none of the above 
More Questions
TLS Online TPP Program

#Question id: 8909

#Part-A Aptitude & General Biotechnology

Which of the following terms or structures is properly associated only with animals?

TLS Online TPP Program

#Question id: 3639

#Part-A Aptitude & General Biotechnology

Replication of a bacterial chromosome normally starts at a fixed point called:

TLS Online TPP Program

#Question id: 10363

#Part-B Specialized Branches in Biotechnology

Free living nitrogen fixing takes place as shown in the following;

             TYPE                                                                                       N-FIXING GENERA

A) Cyanobacteria (blue-green algae)                                        i) Bacillus

B) Aerobic                                                                                     ii) Clostridium

C) Facultative                                                                              iii) Anabaena

D) Anaerobic nonphotosynthetic                                            iv) Rhodospirillum

E) Anaerobic photosynthetic                                                     v) Azospirillum

 Which of the following combination of free living nitrogen fixing bacteria is correct?

TLS Online TPP Program

#Question id: 1583

#Part-B Specialized Branches in Biotechnology

These cells are involved in cell-mediated immunity and destroy virally infected cells:

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG