TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 417
#Part-A Aptitude & General Biotechnology
Muscle contraction involves the conversion of:
TLS Online TPP Program
#Question id: 19788
#Part-A Aptitude & General Biotechnology
Thermal modulation are used in PCR for the function of__
TLS Online TPP Program
#Question id: 18955
#Part-A Aptitude & General Biotechnology
(i) (RFLPs), (ii) (RAPDs), (iii) (VNTR) DNA, and (iv) (SSRs) are the examples of
TLS Online TPP Program
#Question id: 14118
#Part-B Specialized Branches in Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 1562
#Part-A Aptitude & General Biotechnology
________ are cells of the mammalian innate immune response that help destroy tumors.