If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 657

#Part-A Aptitude & General Biotechnology

Structural proteins that typically assemble into large cables or threads to provide mechanical support to cells or organisms are classified as ________ proteins.

TLS Online TPP Program

#Question id: 14254

#Part-B Specialized Branches in Biotechnology

Hybridoma cells immobilized on surfaces of Sephadex beads are used in a packed column for production of monoclonoal antibodies (Mab). Hybridoma concentration is approximately X = 5 g/l in the bed. The flow rate of the synthetic medium and glucose concentration are Q = 2 l/h and S0 = 40 g/l, respectively. The rate constant for Mab formation is k = 1 gX/l-d. Assume that there are no diffusion limitations and glucose is the rate limiting nutrient.  Determine the height of the packed bed for 95% glucose conversion. Bed diameter is D0 = 0.2 m. Neglect the growth of the hybridomas and assume first order kinetics. 

TLS Online TPP Program

#Question id: 14136

#Part-A Aptitude & General Biotechnology

Which of the following statement is incorrect about global alignment? 

(A) Global alignment is based on the Needleman–Wunsch algorithm.

(B) In Global alignment algorithm, an optimal alignment is obtained over the entire lengths of the two sequences.

(C) It is only suitable for aligning two closely related sequences that are of the same length.

(D) GAP is a web-based pairwise global alignment program.

TLS Online TPP Program

#Question id: 10390

#Part-B Specialized Branches in Biotechnology

Phytochromobilin autocatalytically attaches to the PHY apoprotein through

TLS Online TPP Program

#Question id: 6558

#Part-A Aptitude & General Biotechnology

What is the next term in the following sequence 5,7,11,13,17,19,23,29,...