TLS Online TPP Program

#Question id: 4211


If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Part-A Aptitude & General Biotechnology
  1. 6

  2. 14

  3. 10

  4. 7

More Questions
TLS Online TPP Program

#Question id: 4739

#Part-A Aptitude & General Biotechnology

Inheritance of leaf variegation in the four-o’clock plant, Mirabilis jalapa. the leaves and shoots of one variety of four-o’clock were variegated, displaying a mixture of green and white splotches. If  Flowers on the variegated branches gave rise to

TLS Online TPP Program

#Question id: 4740

#Part-A Aptitude & General Biotechnology

Following metabolic pathway for synthesis of anthocyanin product ? Which of the following cross produced all purple phenotype in their progeny ?

TLS Online TPP Program

#Question id: 4741

#Part-A Aptitude & General Biotechnology

The F2 progeny from a particular cross exhibit a modified dihybrid ratio of 9 : 7 (instead of 9 : 3 : 3 : 1). What phenotypic ratio would be expected from a testcross of the F1?

TLS Online TPP Program

#Question id: 4742

#Part-A Aptitude & General Biotechnology

In birds, sex is determined by a ZW chromosome scheme. Males are ZZ and females are ZW. A recessive lethal allele that causes death of the embryo is sometimes present on the Z chromosome in pigeons. What would be the sex ratio in the offspring of a cross between a male that is heterozygous for the lethal allele and a normal female?

TLS Online TPP Program

#Question id: 4742

#Part-B Specialized Branches in Biotechnology

In birds, sex is determined by a ZW chromosome scheme. Males are ZZ and females are ZW. A recessive lethal allele that causes death of the embryo is sometimes present on the Z chromosome in pigeons. What would be the sex ratio in the offspring of a cross between a male that is heterozygous for the lethal allele and a normal female?

TLS Online TPP Program

#Question id: 4743

#Part-A Aptitude & General Biotechnology

Ectrodactyly is an autosomal dominant trait that causes missing middle fingers (lobster claw malformation). A grandfather and grandson both have ectrodactyly, but the intervening father has normal hands by x-ray. Which of the following terms applies to this family?