Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 23268
TLS Online TPP Program

#Question id: 18948

The pore size of the gel depends on the which following two factors

#Part-A Aptitude & General Biotechnology
  1. the total concentration of the acrylamide and bisacrylamide monomers in the solution
  2. the proportion (in per cent) of bisacrylamide in the total monomer concentration
  3. only on monomer concentration
  4. both on a and b
More Questions
TLS Online TPP Program

#Question id: 14662

#Part-A Aptitude & General Biotechnology

The laboratory work using computers and associated with web-based analysis generally online is referred to as __________.
TLS Online TPP Program

#Question id: 4919

#Part-A Aptitude & General Biotechnology

Genes for cytoplasmic male sterility in plants are generally located in
TLS Online TPP Program

#Question id: 15253

#Part-B Specialized Branches in Biotechnology

The water activity in foods that have high levels of salt or sugar is
TLS Online TPP Program

#Question id: 2999

#Part-A Aptitude & General Biotechnology

Agar is superior to gelatin as a solidifying agent because agar
TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG