The PCR procedure, where Taq polymerase is added after the rest of the PCR components are heated to the  DNA melting temperature, so as to avoid non-specific amplification at lower temperatures is

#Question id: 392

#Part-B Specialized Branches in Biotechnology

When an ionic compound such as sodium chloride (NaCl) is placed in water, the component atoms of the NaCl crystal dissociate into individual sodium ions (Na+) and chloride ions (Cl-). In contrast, the atoms of covalently bonded molecules (e.g., glucose, sucrose, glycerol) do not generally dissociate when placed in aqueous solution. Which of the following solutions would be expected to contain the greatest number of solute particles (molecules or ions)?

#Question id: 8926

#Part-B Specialized Branches in Biotechnology

#Question id: 16496

#Part-B Specialized Branches in Biotechnology

#Question id: 11933

#Part-B Specialized Branches in Biotechnology

The excitatory or inhibitory action of a neurotransmitter is determined by which of the following?

#Question id: 4211

#Part-A Aptitude & General Biotechnology

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’