Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 659

#Part-A Aptitude & General Biotechnology

What does it mean to say a protein is oligomeric?

TLS Online TPP Program

#Question id: 4160

#Part-A Aptitude & General Biotechnology

Different tRNA molecules that bind the same amino acid are called __ tRNA molecules.

TLS Online TPP Program

#Question id: 18777

#Part-A Aptitude & General Biotechnology

which of the following technique using antibodies labelled with fluorescent molecules can be used to visualize antigen on or within cells.

TLS Online TPP Program

#Question id: 14131

#Part-B Specialized Branches in Biotechnology

The suitable substitution matrix to align closely related sequences is

TLS Online TPP Program

#Question id: 4198

#Part-A Aptitude & General Biotechnology

An elongation factor EF-Ts serves mainly to