TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#Part-B Specialized Branches in Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 3251

#Part-A Aptitude & General Biotechnology

Looking at 3 allele per locus and following Hardy Weinberg equilibrium what will be the expected heterozygosity if q1=0.5, q2=0.3, q3=0.2

TLS Online TPP Program

#Question id: 3252

#Part-A Aptitude & General Biotechnology

 The unaffected brother of a cystic fibrosis affected girl is referred for genetic counseling. Assume that the population is in Hardy-Weinberg equilibrium. Which of the following is correct?  (Cystic fibrosis is an autosomes recessive inheritance with an incidence of 1 in 2500).

TLS Online TPP Program

#Question id: 3253

#Part-A Aptitude & General Biotechnology

In a population 64% individuals of 1000 population are affected with autosomes dominant diseased. How many individuals are expected carry at least one dominant allele?

TLS Online TPP Program

#Question id: 3254

#Part-A Aptitude & General Biotechnology

Consider a single locus with 2 alleles which are at Hardy-Weinberg equilibrium. If the frequency of the heterozygous genotypes is 0.42, what is the frequency of one homozygote in the population?

TLS Online TPP Program

#Question id: 3255

#Part-A Aptitude & General Biotechnology

The body weight of offspring of bird species is range between 12 gm to 18 gm. In a laboratory experiment, species was subjected to selection pressure having influence on the offspring body weight. After many generations of experimental selection pressure, the body weight range between 16 gm to 24 gm. Which of the following natural selection operate on this species?

TLS Online TPP Program

#Question id: 3256

#Part-A Aptitude & General Biotechnology

There are three alleles, A1, A2, and A3, whose frequencies are equal abundance. According the Hardy-Weinberg equilibrium