Hybridoma cells immobilized on surfaces of Sephadex beads are used in a packed column for production of monoclonoal antibodies (Mab). Hybridoma concentration is approximately X = 5 g/l in the bed. The flow rate of the synthetic medium and glucose concentration are Q = 2 l/h and S0 = 40 g/l, respectively. The rate constant for Mab formation is k = 1 gX/l-d. Assume that there are no diffusion limitations and glucose is the rate limiting nutrient.  Determine the volume of the packed bed for 95% glucose conversion. Bed diameter is D0 = 0.2 m. Neglect the growth of the hybridomas and assume first order kinetics. 

TLS Online TPP Program

#Question id: 14117

#Part-A Aptitude & General Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#Part-B Specialized Branches in Biotechnology

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14119

#Part-A Aptitude & General Biotechnology

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14120

#Part-B Specialized Branches in Biotechnology

Which of the following is not a variant of BLAST?