TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 18852
#Part-A Aptitude & General Biotechnology
What is the starting point for selection of a suitable IEX matrix for purification of a recombinant protein?
TLS Online TPP Program
#Question id: 369
#Part-A Aptitude & General Biotechnology
Calculate the pH of a 2.0 L solution containing 10 mL of 5 M acetic acid and 10 mL of 1 M sodium acetate. (pKa = 4.76)
TLS Online TPP Program
#Question id: 14118
#Part-B Specialized Branches in Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 3511
#Part-A Aptitude & General Biotechnology
What proportional of one round and two wrinkle seed if random selected 3 seed from various seed produced from monohybrid test cross?
TLS Online TPP Program
#Question id: 3012
#Part-B Specialized Branches in Biotechnology
Agar is a sulfated polymer