Stoichiometric equations are used to represent growth of microorganisms provided a ' molecular formula' for the cells is available. The molecular formula for biomass is obtained by measuring the amounts of C, N, H, O and other elements in cells. For a particular bacterial strain, the molecular formula was determined to be C_4.4H_7.30 _1.2N_0.86 . These bacteria are grown under aerobic conditions with hexadecane (C₁₆H₃₄) as substrate. The reaction equation describing growth is:

                                  

  Assuming 100% conversion, what is the yield of cells from hexadecane in g g^-l?   

TLS Online TPP Program

#Question id: 4207

#Part-A Aptitude & General Biotechnology

 If there is more globin than heme present in a reticulocyte, globin synthesis is stopped by

TLS Online TPP Program

#Question id: 4208

#Part-A Aptitude & General Biotechnology

Tryptophan synthesis is controlled by a repressor protein which is activated by a corepressor which is

TLS Online TPP Program

#Question id: 4209

#Part-A Aptitude & General Biotechnology

Tryptophan synthesis can be controlled by a process called attenuation in which the levels of tryptophan in the cell control translation by

TLS Online TPP Program

#Question id: 4211

#Part-A Aptitude & General Biotechnology

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 4302

#Part-A Aptitude & General Biotechnology

Which one of the following proteins is involved in promoter recognition in eukaryotes?

TLS Online TPP Program

#Question id: 4303

#Part-A Aptitude & General Biotechnology

Which component is not directly involved in translation?