Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 23865
TLS Online TPP Program

#Question id: 346

The partial negative charge in a molecule of water occurs because ________.

#Part-B Specialized Branches in Biotechnology

  1. the oxygen atom donates an electron to each of the hydrogen atoms

  2. the electrons shared between the oxygen and hydrogen atoms spend more time around the oxygen atom nucleus than around the hydrogen atom nucleus

  3. the oxygen atom has two pairs of electrons in its valence shell that are not neutralized by hydrogen atoms

  4. one of the hydrogen atoms donates an electron to the oxygen atom

More Questions
TLS Online TPP Program

#Question id: 18612

#Part-A Aptitude & General Biotechnology

A PCR product observed after 6 min. the product will be
a) 100% long product
b) 100% accurate product
c) 50% long product
d) 50% accurate product
TLS Online TPP Program

#Question id: 4211

#Part-A Aptitude & General Biotechnology

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
TLS Online TPP Program

#Question id: 5153

#Part-A Aptitude & General Biotechnology

How many of the following numbers are divisible by 132 ?

264,396,462,792,968,2178,5184,6336
TLS Online TPP Program

#Question id: 677

#Part-A Aptitude & General Biotechnology

A helical wheel can be used to show
TLS Online TPP Program

#Question id: 11609

#Part-A Aptitude & General Biotechnology

All of gibberellins are tetracyclic diterpenoid acids, but only a few of which, have intrinsic biologically active gibberellins these are__