When a mixture of glucose 6-phosphate and fructose 6-phosphate is incubated with the enzyme phosphohexose isomerase (which catalyzes the interconversion of these two compounds) until equilibrium is reached, the final mixture contains twice as much glucose 6-phosphate as fructose 6-phosphate.  Which one of the following statements is best applied to this reaction outlined below? (R = 8.315 J/mol·K; T = 298 K) Glucose 6-phosphate -> fructose 6-phosphate

TLS Online TPP Program

#Question id: 14115

#Part-A Aptitude & General Biotechnology

Which one of the following is a database of protein sequence motifs?

TLS Online TPP Program

#Question id: 14116

#Part-B Specialized Branches in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 

P. A larger E-value indicates higher sequence similarity 

Q. E-value < 10^-10 indicates sequence homology 

R. A higher BLAST score indicates higher sequence similarity 

S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14116

#Part-A Aptitude & General Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 

P. A larger E-value indicates higher sequence similarity 

Q. E-value < 10^-10 indicates sequence homology 

R. A higher BLAST score indicates higher sequence similarity 

S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14117

#Part-B Specialized Branches in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14117

#Part-A Aptitude & General Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG