TLS Online TPP Program

#Question id: 14822


Which of the following pertains to Borrelia burgdorferi?

#Part-B Specialized Branches in Biotechnology
  1. Coccus
  2. Bacillus
  3. Spirochete
  4. Filament
More Questions
TLS Online TPP Program

#Question id: 10339

#Part-B Specialized Branches in Biotechnology

Nitrate assimilates into the root where the conversion of nitrate to nitrite in the cytosol, a reduction reaction that involves the transfer of two electrons catalyzes by an enzyme that is NAD(P)H dependent is known as

TLS Online TPP Program

#Question id: 4211

#Part-A Aptitude & General Biotechnology

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 11611

#Part-B Specialized Branches in Biotechnology

Given below are names of phytohormones in column I and their associated features/effects/ functions in column II.

                     

                    Column I

             ( Phytohormones)

                

                        Column II

                       ( Features)

 

A) Auxin

 

i)  Causes seed germinations

 

B) Cytokinin

 

ii)  Plant Stress Hormone that activates many defense responses

 

C) ABA

 

iii) Polar transport

 

D) Gibberellin

 

iv)  Delayed leaf senescence

 

E) Jasmonic acid

 

v) Causes seed dormancy

 

 







Which of the following combination from the above statements is  correct? 

TLS Online TPP Program

#Question id: 3022

#Part-A Aptitude & General Biotechnology

Late log phase of the bacterial growth curve

TLS Online TPP Program

#Question id: 4150

#Part-A Aptitude & General Biotechnology

Posttranslational glycosylation of proteins is inhibited specifically by: