TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#Part-A Aptitude & General Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 18957

#Part-A Aptitude & General Biotechnology

A DNA fragment of 5000bp needs to be isolated from E.coli (genome size 4x103kb) genomic library. The minimum number of independent recombinant clones required to represent this fragment in genomic library are

TLS Online TPP Program

#Question id: 18958

#Part-A Aptitude & General Biotechnology

The number of clones to represent this fragment in genomic library with a probability of 95% are

TLS Online TPP Program

#Question id: 18959

#Part-A Aptitude & General Biotechnology

 Vectors used for construction of genomic libraries, and their capacity is given match them correctly

A- λ EMBL seriesI - 300kb - 1,400 kb
B - CosmidsII - 45 kb
C - BACs and YACs (high capacity vectors)III - 20kb

TLS Online TPP Program

#Question id: 18960

#Part-A Aptitude & General Biotechnology

cDNA library do not require very large vectors hence which of the following is commonly used in cDNA library

TLS Online TPP Program

#Question id: 18961

#Part-A Aptitude & General Biotechnology

When a cDNA library is generated by first removing those mRNA or cDNA sequences that are common to two sources, e.g., two different Cell types, such a library is called 

TLS Online TPP Program

#Question id: 18962

#Part-A Aptitude & General Biotechnology

1. Presence of oncogenes (iaaM, iaaH and ipt) in T-DNA,

2. Their large size makes the handling procedures during cloning tedious and cumbersome

3. A general lack of unique cloning sites within the T-DNA, which are needed for the insertion of DNA segments to be cloned.

These three problems have been resolved by deleting