Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 12937

#Part-A Aptitude & General Biotechnology

Choose the incorrect statement about Yeast Artificial Chromosome vectors.

TLS Online TPP Program

#Question id: 1553

#Part-B Specialized Branches in Biotechnology

A protein antigen requires to be processed in order to make it

TLS Online TPP Program

#Question id: 4354

#Part-A Aptitude & General Biotechnology

Which of the following statements correctly describes the primary difference between enhancers and proximal control elements?

TLS Online TPP Program

#Question id: 12822

#Part-A Aptitude & General Biotechnology

In measuring the sides of a rectangle, there is an excess of 5% on one side and 2% deficit on the other. Then the error percent in the area is

TLS Online TPP Program

#Question id: 5740

#Part-A Aptitude & General Biotechnology

Pollen from one species germinates on the stigma of another related species and sexually fertilizes the ovule. Most of the resulting plants are sterile but some of the resulting offspring undergo chromosome duplication resulting fertile plants. The fertile offspring are known as