#Question id: 4206
#Part-A Aptitude & General Biotechnology
Ribosomal protein synthesis is controlled by inhibitor proteins, the genes of which are located on the ribosomal protein operon, and which bind to __ when ribosome assembly slows and bind to __ when ribosome assembly is proceeding at a steady rate.
#Question id: 4207
#Part-A Aptitude & General Biotechnology
If there is more globin than heme present in a reticulocyte, globin synthesis is stopped by
#Question id: 4208
#Part-A Aptitude & General Biotechnology
Tryptophan synthesis is controlled by a repressor protein which is activated by a corepressor which is
#Question id: 4209
#Part-A Aptitude & General Biotechnology
Tryptophan synthesis can be controlled by a process called attenuation in which the levels of tryptophan in the cell control translation by
#Question id: 4211
#Part-A Aptitude & General Biotechnology
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
#Question id: 4302
#Part-A Aptitude & General Biotechnology
Which one of the following proteins is involved in promoter recognition in eukaryotes?
