TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 6544
#Part-A Aptitude & General Biotechnology
Find the missing number in the sequence ?
61,52,63,94,... ,18,001,121
TLS Online TPP Program
#Question id: 4905
#Part-A Aptitude & General Biotechnology
Which of the correct feature of genetic material effect?
TLS Online TPP Program
#Question id: 375
#Part-A Aptitude & General Biotechnology
The aqueous solution with the lowest pH is:
TLS Online TPP Program
#Question id: 14118
#Part-B Specialized Branches in Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 18912
#Part-A Aptitude & General Biotechnology
In PBR322,n in the AmpR there are restriction site are for PstI, while tetracycline resistance have restriction site are for