Lyme disease is an example of a disease

#Question id: 532

#Part-B Specialized Branches in Biotechnology

In glycolysis, fructose 1,6-bisphosphate is converted to two products with a standard free-energy change (DG'°) of 23.8 kJ/mol.  Under what conditions (encountered in a normal cell) will the free-energy change (DG) be negative, enabling the reaction to proceed to the right?

#Question id: 11265

#Part-B Specialized Branches in Biotechnology

Approximately how many kg of carnivore production can be supported by a field plot containing 2000 kg of plant material?

#Question id: 11282

#Part-B Specialized Branches in Biotechnology

Which of the following ecosystems would likely have the largest net primary productivity per hectare and why?

#Question id: 18994

#Part-A Aptitude & General Biotechnology

#Question id: 4211

#Part-A Aptitude & General Biotechnology

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’