TLS Online TPP Program

#Question id: 3010


Endospores

#Part-B Specialized Branches in Biotechnology
  1. are a form of reproduction.

  2. are a dormant form of a bacterium.

  3. are formed by members of medically relevant groups of bacteria.

  4. are involved in anaerobic respiration.

More Questions
TLS Online TPP Program

#Question id: 891

#Part-B Specialized Branches in Biotechnology

The folding pathways of some proteins require two enzymes that catalyze isomerization reactions such as,

a) Peptide prolyl isomerase (PPI)  catalyzes the elimination of folding intermediates with inappropriate disulfide cross-links

b) Protein disulfide isomerase (PDI) enzyme that catalyzes the interchange, or shuffling, of disulfide bonds until the bonds of the native conformation are formed

c) Peptide prolyl cis-trans isomerase (PPI) catalyzes the interconversion of the cis and trans isomers of Proline residue peptide bonds

d) Peptide prolyl isomerase (PPI) can be a fast step in the folding of proteins that contain some Pro peptide bonds in the cis conformation

Which of the following combinations is correct about protein folding pathways?

TLS Online TPP Program

#Question id: 707

#Part-B Specialized Branches in Biotechnology

A repeating structural unit in a multimeric protein is known as a(n):

TLS Online TPP Program

#Question id: 7473

#Part-A Aptitude & General Biotechnology

At what time between 6 to 7 o’ clock minute and hour hand will Coincide ?

TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 3027

#Part-B Specialized Branches in Biotechnology

Which of the following contains a copy of the chromosome, along with a small amount of dehydrated cytoplasm, within a tough wall?