TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 4749

#Section 3: Genetics, Cellular and Molecular Biology

A normal woman, whose father was Hemophilic and color blind is married to a colorblind, nonhemophilic man. What will be probability of colorblind, hemophilic daughter?

TLS Online TPP Program

#Question id: 4751

#Section 3: Genetics, Cellular and Molecular Biology

In the following example, 3 independently assorting genes are known to govern coat color in mice. The genotype of few of the coat colors is given below:

Agouti: A-B-C- Black: aa B-C - Albino: -- -- cc

What will be the expected frequency of abino, in progeny from crosses of  AaBbCc with albino of the genotype aabbcc?

TLS Online TPP Program

#Question id: 4752

#Section 3: Genetics, Cellular and Molecular Biology

Red-green color blindness is caused by a sex-linked recessive allele. A color-blind man marries a woman with normal vision whose father was color-blind. What is the probability that they will have a color-blind daughter? What is the probability that their first son will be color-blind respectively?

TLS Online TPP Program

#Question id: 4753

#Section 3: Genetics, Cellular and Molecular Biology

Pattern baldness in humans is a sex-influenced trait that is autosomes dominant in males and recessive in females. What is genotype of both parents with normal hair had one son with pattern baldness and another son is normal hair?

TLS Online TPP Program

#Question id: 4754

#Section 3: Genetics, Cellular and Molecular Biology

Allele A is epistatic to allele B. Which of the following statement are incorrect?

TLS Online TPP Program

#Question id: 4755

#Section 3: Genetics, Cellular and Molecular Biology

When two albino snails were crossed, all of the F1 were pigmented. All F1 intercross would results