TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 10802

#Section 6: Plant, Animal and Microbial Biotechnology

Condensed tannins are the polymerizing subunits of__

TLS Online TPP Program

#Question id: 10803

#Section 6: Plant, Animal and Microbial Biotechnology

Which of the following are not consider as nitrogen-containing secondary metabolites?

TLS Online TPP Program

#Question id: 10804

#Section 6: Plant, Animal and Microbial Biotechnology

Major types of alkaloids, their amino acid precursors, and well-known examples of each type;

Alkaloid class

Biosynthetic precursor

Examples

A. Pyrrolidine

i. Lysine

a. Coniine

B. Tropane

ii. Ornithine

b. Retrorsine

C. Piperidine

 

c. Lupinine

D. Pyrrolizidine

 

d. Nicotine

E. Quinolizidine

 

e. Atropine and Cocaine

Which of the following combination from the given table is correct?

TLS Online TPP Program

#Question id: 10805

#Section 6: Plant, Animal and Microbial Biotechnology

Breakdown of cyanogenic glycosides in plants is a two-step enzymatic process, the enzymes necessary to hydrolyze the sugar and liberate HCN is

TLS Online TPP Program

#Question id: 10806

#Section 6: Plant, Animal and Microbial Biotechnology

HCN is a fast-acting toxin that inhibits

TLS Online TPP Program

#Question id: 10807

#Section 6: Plant, Animal and Microbial Biotechnology

Cyanogenic Glycosides and Glucosinolates are nitrogen containing secondary metabolites in plants. Following are some statements regarding the action of Cyanogenic Glycosides and Glucosinolates;

a) Cyanogenic Glycosides release the poison hydrogen cyanide by the action of enzyme known as Hydroxynitrile lyase

b) Release of the mustard-smelling volatiles from glucosinolates is catalyzed by a hydrolytic enzyme, called a thioglucosidase or myrosinase

c) substerate for Glycosidase is Cyanogenic glycoside and Thioglucosidase is Aglycone

d) Like cyanogenic glycosides, glucosinolates are stored in the intact plant separately from the enzymes that hydrolyze them, and they are brought into contact with these enzymes only when the plant is crushed

Which of the following combinations of above statement is true?