Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14984

#Section 6: Plant, Animal and Microbial Biotechnology

Just beneath the plasma membrane  many protozoa and some algae have a different external, rigid layer of components. The structure is called as

TLS Online TPP Program

#Question id: 14156

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

A short stretch of identical residues in FASTA is called 

TLS Online TPP Program

#Question id: 1954

#Section 2: General Biology

What is the single best description of type 1 diabetes?

TLS Online TPP Program

#Question id: 15894

#Section 6: Plant, Animal and Microbial Biotechnology

Activated charcoal is used in nutrition media to_____

TLS Online TPP Program

#Question id: 1138

#Section 3: Genetics, Cellular and Molecular Biology

A loss-of-function mutation in Wnt would have a phenotype similar to a

a. gain-of-function mutation in GSK-3.                    

b. gain-of-function mutation in β-catenin.

c. loss-of-function mutation in GSK-3.                     

d. loss-of-function mutation in β-catenin.