The viscosity of a fluid changes with either stirrer speed or mixing time. But when mixing ceases, the viscosity returns to its original state. This fluid is best described as 

TLS Online TPP Program

#Question id: 15587

#Section 4: Fundamentals of Biological Engineering

Under unaerated conditions in a fermenter, the power consumed by a single impeller is 10 KW and upon changing the agitation rate from 200 to 600 rpm, the new power consumption (KW) would be -----. (Assuming that the power number remains constant)

TLS Online TPP Program

#Question id: 625

#Section 2: General Biology

For enzymes in which the slowest (rate-limiting) step is the reaction Km becomes equivalent to:

TLS Online TPP Program

#Question id: 10264

#Section 3: Genetics, Cellular and Molecular Biology

Chiasmata formation occurs during

TLS Online TPP Program

#Question id: 2508

#Section 3: Genetics, Cellular and Molecular Biology

If you treated cells with a drug that interferes with microtubules, such as colchicine, which of the following would result?

A. Cell shape would be disrupted.

B. Mitosis and meiosis would not occur.

C. The intracellular location of organelles would be disrupted.

TLS Online TPP Program

#Question id: 13096

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?