Following are some statements regarding CO2 assmilation;

a.) The reduction process-Hydroxypyruvate convert into Glycerate in Peroxisomes in Glycolate pathway

b.) In Calvin-Benson cycle action of Transketolase produces erythrose 4-phosphate and xylulose 5-phosphate during regeneration step

c.) In C4 cycle phosphoenolpyruvate carboxylase (PEPCase), catalyzes the initial carboxylation in mesophyll cells close to the external atmosphere

d.) The stomata of CAM plants open at night

Which of the following above statements combination TRUE?

TLS Online TPP Program

#Question id: 14114

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

‘A laboratory, where drugs, chemicals, and other types of biological matter can be analysed and tested by using various liquids’ is called 

TLS Online TPP Program

#Question id: 14115

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which one of the following is a database of protein sequence motifs?

TLS Online TPP Program

#Question id: 14116

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 

P. A larger E-value indicates higher sequence similarity 

Q. E-value < 10^-10 indicates sequence homology 

R. A higher BLAST score indicates higher sequence similarity 

S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14117

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is incorrect regarding sequence homology?