Which of the following processes are not correct for conjugation?

TLS Online TPP Program

#Question id: 14251

#Section 5: Bioprocess Engineering and Process Biotechnology

Yeast cells are recovered from a fermentation broth by using a tubular centrifuge. Sixty percent (60%) of the cells are recovered at a flow rate of 12 l/min with a rotational speed of 4000 rpm. Recovery is inversely proportional to flow rate. a. To increase the recovery of cells to 95% at the same flow rate, what should be the rpm of the centrifuge?

____________________

TLS Online TPP Program

#Question id: 17285

#Section 1: Engineering Mathematics

If the arithmetic mean of the data given below is 28, 

The median of the series is  

TLS Online TPP Program

#Question id: 19963

#Section 5: Bioprocess Engineering and Process Biotechnology

Growth yield coefficient is defined as: 

TLS Online TPP Program

#Question id: 14431

#Section 5: Bioprocess Engineering and Process Biotechnology

the centrifugal separation of biomass of 80um sized cells of density 1.04kgm^-3 was carried out in a tubular centrifuge having a diameter of 15cm and rotating at 1200 rev/min. calculate the residence time if distance between the liquid surface and the axis of rotation was 0.8cm, the liquid viscosity were 1.0kgm^-3 and 0.013 gcm^-ls-1respectively. 

TLS Online TPP Program

#Question id: 13100

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?