Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 12253
TLS Online TPP Program

#Question id: 13100

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. 70% Identity
  2. 30% Identity
  3. 80% Identity
  4. 50% Identity
More Questions
TLS Online TPP Program

#Question id: 21728

#Section 5: Bioprocess Engineering and Process Biotechnology

In the reaction A → products, we find that when [A] has fallen to half of its initial value, the reaction proceeds at the same rate as its initial rate. Is the reaction zero order, first order, or second order?
TLS Online TPP Program

#Question id: 21729

#Section 5: Bioprocess Engineering and Process Biotechnology

In the reaction, A → products, with the initial concentration [A]0 = 1.512 M, [A] is found to be 1.496 M at t = 30 s. With the initial concentration [A]0 = 2.584 M, [A] is found to be 2.552 M at t = 1 min. What is the order of this reaction?
TLS Online TPP Program

#Question id: 21730

#Section 5: Bioprocess Engineering and Process Biotechnology

In the first-order decomposition of dinitrogen pentoxide at 335 K,
N2O5(g) → 2 NO2(g) + ½ O2(g)
if we start with a 2.50-g sample of N2O5 at 335 K and have 1.50 g remaining after 109 s, 
(a) What is the value of the rate constant k? 
(b) What is the half-life of the reaction? 
TLS Online TPP Program

#Question id: 21731

#Section 5: Bioprocess Engineering and Process Biotechnology

The smog constituent peroxyacetyl nitrate (PAN) dissociates into peroxyacetyl radicals and NO2(g) in a first order reaction with a half-life of 32 min. 
If the initial concentration of PAN in an air sample is 2.7×1015 molecules/L, what will be the concentration 2.24 h later?
TLS Online TPP Program

#Question id: 21732

#Section 5: Bioprocess Engineering and Process Biotechnology

Rate constants for the first-order decomposition of acetonedicarboxylic acid
CO(CH2COOH)2(aq) → CO(CH3)2(aq) + 2 CO2(g)
are k = 4.75 ×10–4 s–1 at 293 K and k = 1.63 ×10–3 at 303 K. What is the activation energy, Ea, for this reaction?
TLS Online TPP Program

#Question id: 21733

#Section 5: Bioprocess Engineering and Process Biotechnology

A rate law __________.