You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

#Question id: 14307

#Section 5: Bioprocess Engineering and Process Biotechnology

Pseudomonas putida with mm = 0.5 h^-1 is cultivated in a continuous culture under aerobic conditions where D = 0.28 h^-1 . The carbon and energy source in the feed is lactose with aconcentration of S₀ = 2 g/l. The effluent lactose concentration is desired to be S = 0.1 g/l. If the growth rate is limited by oxygen transfer, by using the following information

Determine specific rate of oxygen consumption (q_O2 ).

#Question id: 14308

#Section 5: Bioprocess Engineering and Process Biotechnology

Pseudomonas putida with µm = 0.5 h^-1 is cultivated in a continuous culture under aerobic conditions where D = 0.28 h^-1 . The carbon and energy source in the feed is lactose with aconcentration of S₀ = 2 g/l. The effluent lactose concentration is desired to be S = 0.1 g/l. If the growth rate is limited by oxygen transfer, by using the following information:

What should be the oxygen-transfer coefficient (k_La) in order to overcome oxygentransfer limitation (i.e., CL = 2 mg/l)? ___________________

#Question id: 14309

#Section 5: Bioprocess Engineering and Process Biotechnology

Glucose is converted to ethanol by immobilized yeast cells entrapped in gel beads. The specific rate of ethanol production is: q_P = 0.2 g ethanol/g-cell-h. The effectiveness factor for an average bead is 0.8. Each bead contains 50 g/L of cells. The voids volume in the column is 40%. Assume growth is negligible (all glucose is converted into ethanol). The feed flow rate is F = 400 l/h and glucose concentration in the feed is S_0i = 150 g glucose/l. The diameter of the column is 1 m and the yield coefficient is about 0.49 g ethanol/g glucose. The column height is 4 m. What is the glucose conversion at the exit of the column?

#Question id: 14310

#Section 5: Bioprocess Engineering and Process Biotechnology

Glucose is converted to ethanol by immobilized yeast cells entrapped in gel beads. The specific rate of ethanol production is: q_P = 0.2 g ethanol/g-cell-h. The effectiveness factor for an average bead is 0.8. Each bead contains 50 g/L of cells. The voids volume in the column is 40%. Assume growth is negligible (all glucose is converted into ethanol). The feed flow rate is F = 400 l/h and glucose concentration in the feed is S_0i = 150 g glucose/l. The diameter of the column is 1 m and the yield coefficient is about 0.49 g ethanol/g glucose. The column height is 4 m. What is the ethanol concentration in the exit stream?

#Question id: 14311

#Section 5: Bioprocess Engineering and Process Biotechnology

Consider following fig, which applies to a fed-batch system.

Assume at t = 0, V = 100 l, X = 2 g/l, m = 1 h-1 , S0 = 4 g/l, and S = 0.01 g/l. V is increased at a constant rate such that dV/dt = 20 l/h = F (or flow rate) and X is constant at all times. What is µ at t = 5 h?

#Question id: 14312

#Section 5: Bioprocess Engineering and Process Biotechnology

An industrial waste-water stream is fed to a stirred-tank reactor continuously and the cells are recycled back to the reactor from the bottom of the sedimentation tank placed after the reactor. The following are given for the system: F = 100 l/h; S0 = 5000 mg/l; mm = 0.25 h-1 ; Ks = 200 mg/l; α (recycle ratio) = 0.6; C (cell concentration factor) = 2; Y ^M _X/S = 0.4. The effluent concentration is desired to be 100 mg/l.  Determine the required reactor volume.