You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

#Question id: 14161

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

#Question id: 14162

#Section 4: Fundamentals of Biological Engineering

A continuous process is set up for treatment of wastewater. Each day, 10⁵ kg cellulose and 10³ kg bacteria enter in the feed stream, while 10⁴ kg cellulose and 1.5 x 10⁴ kg bacteria leave in the effluent. The rate of cellulose digestion by the bacteria is 7 x 10⁴ kg d^-1. The rate of bacterial growth is 2 x 10⁴ kg d^-1 ; the rate of cell death by lysis is 5 x 10² kg d^-1. Write balances for cellulose and bacteria in the system.

#Question id: 14162

#Section 5: Bioprocess Engineering and Process Biotechnology

A continuous process is set up for treatment of wastewater. Each day, 10⁵ kg cellulose and 10³ kg bacteria enter in the feed stream, while 10⁴ kg cellulose and 1.5 x 10⁴ kg bacteria leave in the effluent. The rate of cellulose digestion by the bacteria is 7 x 10⁴ kg d^-1. The rate of bacterial growth is 2 x 10⁴ kg d^-1 ; the rate of cell death by lysis is 5 x 10² kg d^-1. Write balances for cellulose and bacteria in the system.

#Question id: 14163

#Section 4: Fundamentals of Biological Engineering

A stream of growth medium containing 60% glucose and 40% growth factor A flowing at 500 kg per hour was divided into two feed streams for different cell cultures. One fourth of the growth medium was sent to fermenter 1 and the rest was sent to fermenter 2. What is the flow rates of glucose and growth factor A in the feed streams for the two fermenters

#Question id: 14163

#Section 5: Bioprocess Engineering and Process Biotechnology

A stream of growth medium containing 60% glucose and 40% growth factor A flowing at 500 kg per hour was divided into two feed streams for different cell cultures. One fourth of the growth medium was sent to fermenter 1 and the rest was sent to fermenter 2. What is the flow rates of glucose and growth factor A in the feed streams for the two fermenters

#Question id: 14164

#Section 4: Fundamentals of Biological Engineering

Stoichiometric equations are used to represent growth of microorganisms provided a ' molecular formula' for the cells is available. The molecular formula for biomass is obtained by measuring the amounts of C, N, H, O and other elements in cells. For a particular bacterial strain, the molecular formula was determined to be C_4.4H_7.30 _1.2N_0.86 . These bacteria are grown under aerobic conditions with hexadecane (C₁₆H₃₄) as substrate. The reaction equation describing growth is:

  Assuming 100% conversion, what is the yield of cells from hexadecane in g g^-l?