TLS Online TPP Program

#Question id: 13095


You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. -
  2. -
  3. -
  4. -
More Questions
TLS Online TPP Program

#Question id: 4812

#Section 3: Genetics, Cellular and Molecular Biology

Two character X and Y ,both follow law of dominance due to 3:1 F2 phenotypic ratio monohybrid cross separately If carry out dihybrid selfing cross for heterozygous genotype for both character does not follow law of independence assortment in normal environmental condition due to?

TLS Online TPP Program

#Question id: 4813

#Section 3: Genetics, Cellular and Molecular Biology

You perform the three different two-factor crosses (Cross 1: XY and xy, Cross 2: YZ and yz, and Cross 3: XZ and xz). Assume all crosses are between diploid flies homozygous for the alleles of these genes. You observe 7% recombinants in the first cross, 20% recombinants in the second cross, and 13% recombinants in the third cross. if cross between XyZ and xYz leads to which of the followining recombinant with double cross over .

TLS Online TPP Program

#Question id: 4814

#Section 3: Genetics, Cellular and Molecular Biology

The frequency of recombinant gametes is half the frequency of crossing over between genes present on same chromosome is due to

TLS Online TPP Program

#Question id: 4815

#Section 3: Genetics, Cellular and Molecular Biology

The cross over percentage between linked genes J and M is 20%, J and L is 35%, J and N is 70%, L and K is 15%, M and N 50%. The sequence of genes on the chromosome is

TLS Online TPP Program

#Question id: 4816

#Section 3: Genetics, Cellular and Molecular Biology

A wild-type fruit fly heterozygous for gray body color and normal wings was mated with a black fly with vestigial wings to produced 1000 offspring. Recombination frequency between these genes for body color and wing type is 20 %. What number of offspring that is gray body colour and normal wing?

TLS Online TPP Program

#Question id: 4817

#Section 3: Genetics, Cellular and Molecular Biology

How many different gametes can be formed by an organism with genotype AaBbCCddEe, If a, b and c gene are completely link?