Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 12815
TLS Online TPP Program

#Question id: 14606

Cohn's equation which is given following used to describe the phenomenon of Log S = beta-k1 

#Section 5: Bioprocess Engineering and Process Biotechnology
  1. Solubility of protein 
  2. Mass of protein 
  3. Enzyme activity 
  4. Cell growth kinetic 
More Questions
TLS Online TPP Program

#Question id: 13030

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

The mutation in Vir F will cause the interference in –
TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 12906

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

An alternative method labeling strategy used in karyotyping and gene localisation is _______
TLS Online TPP Program

#Question id: 351

#Section 4: Fundamentals of Biological Engineering

 If the cytoplasm of a cell is at pH 7, and the mitochondrial matrix is at pH 8, then the concentration of H+ ions ________.
TLS Online TPP Program

#Question id: 119

#Section 2: General Biology

Tay-Sachs disease is the result of a genetic defect in the metabolism of: