What is the chance of throwing a number greater than 4 with an ordinary die whose faces are numbered from 1 to 6 ?

TLS Online TPP Program

#Question id: 1144

#Section 3: Genetics, Cellular and Molecular Biology

Which of the following is NOT a common intracellular second messenger?

TLS Online TPP Program

#Question id: 16833

#General Aptitude

Which of the 4 figures presented (A, B, C, D) is a rotation of the first?

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14469

#Section 1: Engineering Mathematics

The absolute minimum of 

TLS Online TPP Program

#Question id: 2076

#Section 2: General Biology

An organism with a cell wall would most likely be unable to take in materials through: