From a pack of 52 cards two are drawn at random. The probability that one is a king and the other a queen is

TLS Online TPP Program

#Question id: 14116

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 

P. A larger E-value indicates higher sequence similarity 

Q. E-value < 10^-10 indicates sequence homology 

R. A higher BLAST score indicates higher sequence similarity 

S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14117

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14120

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is not a variant of BLAST?

TLS Online TPP Program

#Question id: 14121

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is not the classification of SCOP?