The water activity in foods that have high levels of salt or sugar is

TLS Online TPP Program

#Question id: 13035

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Each band on the gel represents a different protein (or protein subunit); _____ proteins move through the gel more _____ than_____ proteins and therefore are found nearer the _____ of the gel.

TLS Online TPP Program

#Question id: 21391

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which one of the following biosensors is also known as a piezoelectric device?

TLS Online TPP Program

#Question id: 12921

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Match the following:-

A. Gene probe production.              i. Novel proteins

B. Genome mapping.                       ii. PCR mutagenesis

C. Protein Engineering.                 iii. Sequence tagged sites

D. Gene Editing.                                iv. Use with blots

TLS Online TPP Program

#Question id: 10136

#Section 2: General Biology

A protein complex contain a Rieske protein known as

TLS Online TPP Program

#Question id: 13095

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.