There are two classes A and B consisting of 40 and 52 student respectively . If the average of weight of class A is 45kg and that of class B is 40kg.Find the average of weight of all the student of class A and B.

TLS Online TPP Program

#Question id: 16570

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Agarose gels are used for the electrophoresis of

TLS Online TPP Program

#Question id: 65

#Section 2: General Biology

Identify which of the following pair is enantiomers, diastereomers or meso compounds.

TLS Online TPP Program

#Question id: 14943

#Section 1: Engineering Mathematics

If z = x⁴ + 3xy - y² and y = sin x then dz/dx is

TLS Online TPP Program

#Question id: 14091

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

An example of a composite database:

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG