TLS Online TPP Program

#Question id: 17663


The Smith-Waterman algorithm was developed for

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. Local pairwise sequence alignment 
  2. Global pairwise sequence alignment 
  3. Multiple sequence alignment
  4. Structural alignment 
More Questions
TLS Online TPP Program

#Question id: 14113

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

SWISS-PROT is related to 

TLS Online TPP Program

#Question id: 14114

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

‘A laboratory, where drugs, chemicals, and other types of biological matter can be analysed and tested by using various liquids’ is called 

TLS Online TPP Program

#Question id: 14115

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which one of the following is a database of protein sequence motifs?

TLS Online TPP Program

#Question id: 14116

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 
P. A larger E-value indicates higher sequence similarity 
Q. E-value < 10^-10 indicates sequence homology 
R. A higher BLAST score indicates higher sequence similarity 
S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14117

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 
P. Maximum parsimony 
Q. Neighbor joining 
R. Maximum likelihood 
S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG