TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 14113
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
SWISS-PROT is related to
TLS Online TPP Program
#Question id: 14114
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
‘A laboratory, where drugs, chemicals, and other types of biological matter can be analysed and tested by using various liquids’ is called
TLS Online TPP Program
#Question id: 14115
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Which one of the following is a database of protein sequence motifs?
TLS Online TPP Program
#Question id: 14116
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm?
P. A larger E-value indicates higher sequence similarity
Q. E-value < 10^-10 indicates sequence homology
R. A higher BLAST score indicates higher sequence similarity
S. E-value > 10^10 indicates sequence homology
TLS Online TPP Program
#Question id: 14117
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Identify the character based method used for the construction of a phylogenetic tree.
P. Maximum parsimony
Q. Neighbor joining
R. Maximum likelihood
S. Bootstrapping
TLS Online TPP Program
#Question id: 14118
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
