TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 4735
#Section 3: Genetics, Cellular and Molecular Biology
In corn, three dominant alleles, called A, C, and R, must be present to produce colored seeds. Genotype A/–; C/– ; R/– is colored; all others are colorless. A colored plant AaCCRr is crossed with colorless plant aaCcRr. What proportional of offspring plant with colorless seed?
TLS Online TPP Program
#Question id: 13101
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two protein sequences?
TLS Online TPP Program
#Question id: 15576
#Section 5: Bioprocess Engineering and Process Biotechnology
For which of the following, the units of rate constant and rate of reaction are same?
TLS Online TPP Program
#Question id: 15599
#Section 1: Engineering Mathematics
Find the positive real root of x3 - x - 3 = 0 using Newton-Raphson method. If the starting guess (x0) is 2, the numerical value of the root after two iterations (x2) is (round off to two decimal places).
TLS Online TPP Program
#Question id: 19959
#Section 5: Bioprocess Engineering and Process Biotechnology
In high-fructose corn syrup industry, which enzyme is used for fructose production