Practice Questions

TLS Online TPP Program

#Question id: 547

The role of an enzyme in an enzyme-catalyzed reaction is to:

#I Life Science/ Life Sciences Group – I-V

bind a transition state intermediate, such that it cannot be converted back to substrate.
ensure that all of the substrate is converted to product.
ensure that the product is more stable than the substrate.
increase the rate at which substrate is converted into product.

More Questions

TLS Online TPP Program

#Question id: 3864

#SCPH01 Biochemistry

RNA polymerase:

TLS Online TPP Program

#Question id: 3882

#SCPH01 Biochemistry

The reverse transcriptase of an animal RNA virus catalyzes:

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 1063

#SCPH28 | Zoology

A key feature of all viral infections is the

TLS Online TPP Program

#Question id: 3007

#I Life Science/ Life Sciences Group – I-V

Bacterial endospores function in